Review




Structured Review

GenScript corporation ptol2-egfp vector cmv promoter
Overexpression of gonacin in the whole body could enhance the body growth, serum glucose, and food intake <t>of</t> <t>zebrafish</t> (A) Overexpression of gonacin in whole body by the establishment of gonacin transgenic zebrafish driven by <t>CMV</t> promoter. (B) The expression of gonacin was detected in the embryos of wild type (WT) and Tg(CMV:gonacin) at 8 dpf, using ef1a as an internal control. ∗∗∗, p < 0.001; Unpaired Student’s t test was used to calculate the p value. (C) Assessment of the food intake in Tg(CMV:gonacin) . The food intake was assessed in WT and Tg(CMV:gonacin) at 55 dpf (panel a, n = 15 in each group). ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001; two-way ANOVA with Sidak’s multiple comparisons test was used to calculate the p value. (D) The morphology of WT and Tg(CMV:gonacin) zebrafish at 50 dpf. Scale bar: 0.5 cm. (E) Body weight (left panel) and body length (right panel) of WT and Tg(CMV:gonacin) at 50 dpf. ∗∗, p < 0.01; ∗∗∗, p < 0.001 compared with WT (n = 10). (F) Overexpression of gonacin in whole body by the establishment of gonacin transgenic zebrafish driven by hsp70 promoter. (G) The expression of gonacin was detected in the ovary of wild type (WT) and Tg(hsp70:gonacin) at 70 dpf after after 40°C heat shock for 1 h (n = 5 in each group), using ef1a as an internal control. ∗∗, p < 0.01; Unpaired Student’s t test was used to calculate the p value. (H) Assessment of the food intake in Tg(hsp70:gonacin) . The food intake was assessed in WT and Tg(hsp70:gonacin) at 70 dpf (panel a, n = 15 in each group). ∗, p < 0.05; ∗∗∗∗, p < 0.0001, two-way ANOVA with Sidak’s multiple comparisons test was used to calculate the p value. (I) Assessment of the blood glucose in Tg(hsp70:gonacin) . The blood glucose was assessed in WT and Tg(hsp70:gonacin) at 70 dpf after 40°C heat shock for 1 h (n = 5 in each group). ∗∗, p < 0.01; Unpaired Student’s t test was used to calculate the p value. (J) The expression of glucogenesis enzymes including pck1 , pcxa , pcxb , and fbp1b , in the liver in WT and Tg(hsp70:gonacin) at 70 dpf after 40°C heat shock for 1 h (n = 5 in each group). The columns represent fold changes of the relative mRNA levels in the Tg(hsp70:gonacin) group over its respective WT controls (mean ± SEM) ∗, p < 0.05; ∗∗, p < 0.01; n = 5. Unpaired Student’s t test was used to calculate the p value.
Ptol2 Egfp Vector Cmv Promoter, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ptol2-egfp vector cmv promoter/product/GenScript corporation
Average 90 stars, based on 1 article reviews
ptol2-egfp vector cmv promoter - by Bioz Stars, 2026-03
90/100 stars

Images

1) Product Images from "Gonacin: A germ cell-derived hormone with glucogenic, orexigenic, and gonadal activities"

Article Title: Gonacin: A germ cell-derived hormone with glucogenic, orexigenic, and gonadal activities

Journal: iScience

doi: 10.1016/j.isci.2023.108065

Overexpression of gonacin in the whole body could enhance the body growth, serum glucose, and food intake of zebrafish (A) Overexpression of gonacin in whole body by the establishment of gonacin transgenic zebrafish driven by CMV promoter. (B) The expression of gonacin was detected in the embryos of wild type (WT) and Tg(CMV:gonacin) at 8 dpf, using ef1a as an internal control. ∗∗∗, p < 0.001; Unpaired Student’s t test was used to calculate the p value. (C) Assessment of the food intake in Tg(CMV:gonacin) . The food intake was assessed in WT and Tg(CMV:gonacin) at 55 dpf (panel a, n = 15 in each group). ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001; two-way ANOVA with Sidak’s multiple comparisons test was used to calculate the p value. (D) The morphology of WT and Tg(CMV:gonacin) zebrafish at 50 dpf. Scale bar: 0.5 cm. (E) Body weight (left panel) and body length (right panel) of WT and Tg(CMV:gonacin) at 50 dpf. ∗∗, p < 0.01; ∗∗∗, p < 0.001 compared with WT (n = 10). (F) Overexpression of gonacin in whole body by the establishment of gonacin transgenic zebrafish driven by hsp70 promoter. (G) The expression of gonacin was detected in the ovary of wild type (WT) and Tg(hsp70:gonacin) at 70 dpf after after 40°C heat shock for 1 h (n = 5 in each group), using ef1a as an internal control. ∗∗, p < 0.01; Unpaired Student’s t test was used to calculate the p value. (H) Assessment of the food intake in Tg(hsp70:gonacin) . The food intake was assessed in WT and Tg(hsp70:gonacin) at 70 dpf (panel a, n = 15 in each group). ∗, p < 0.05; ∗∗∗∗, p < 0.0001, two-way ANOVA with Sidak’s multiple comparisons test was used to calculate the p value. (I) Assessment of the blood glucose in Tg(hsp70:gonacin) . The blood glucose was assessed in WT and Tg(hsp70:gonacin) at 70 dpf after 40°C heat shock for 1 h (n = 5 in each group). ∗∗, p < 0.01; Unpaired Student’s t test was used to calculate the p value. (J) The expression of glucogenesis enzymes including pck1 , pcxa , pcxb , and fbp1b , in the liver in WT and Tg(hsp70:gonacin) at 70 dpf after 40°C heat shock for 1 h (n = 5 in each group). The columns represent fold changes of the relative mRNA levels in the Tg(hsp70:gonacin) group over its respective WT controls (mean ± SEM) ∗, p < 0.05; ∗∗, p < 0.01; n = 5. Unpaired Student’s t test was used to calculate the p value.
Figure Legend Snippet: Overexpression of gonacin in the whole body could enhance the body growth, serum glucose, and food intake of zebrafish (A) Overexpression of gonacin in whole body by the establishment of gonacin transgenic zebrafish driven by CMV promoter. (B) The expression of gonacin was detected in the embryos of wild type (WT) and Tg(CMV:gonacin) at 8 dpf, using ef1a as an internal control. ∗∗∗, p < 0.001; Unpaired Student’s t test was used to calculate the p value. (C) Assessment of the food intake in Tg(CMV:gonacin) . The food intake was assessed in WT and Tg(CMV:gonacin) at 55 dpf (panel a, n = 15 in each group). ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001; two-way ANOVA with Sidak’s multiple comparisons test was used to calculate the p value. (D) The morphology of WT and Tg(CMV:gonacin) zebrafish at 50 dpf. Scale bar: 0.5 cm. (E) Body weight (left panel) and body length (right panel) of WT and Tg(CMV:gonacin) at 50 dpf. ∗∗, p < 0.01; ∗∗∗, p < 0.001 compared with WT (n = 10). (F) Overexpression of gonacin in whole body by the establishment of gonacin transgenic zebrafish driven by hsp70 promoter. (G) The expression of gonacin was detected in the ovary of wild type (WT) and Tg(hsp70:gonacin) at 70 dpf after after 40°C heat shock for 1 h (n = 5 in each group), using ef1a as an internal control. ∗∗, p < 0.01; Unpaired Student’s t test was used to calculate the p value. (H) Assessment of the food intake in Tg(hsp70:gonacin) . The food intake was assessed in WT and Tg(hsp70:gonacin) at 70 dpf (panel a, n = 15 in each group). ∗, p < 0.05; ∗∗∗∗, p < 0.0001, two-way ANOVA with Sidak’s multiple comparisons test was used to calculate the p value. (I) Assessment of the blood glucose in Tg(hsp70:gonacin) . The blood glucose was assessed in WT and Tg(hsp70:gonacin) at 70 dpf after 40°C heat shock for 1 h (n = 5 in each group). ∗∗, p < 0.01; Unpaired Student’s t test was used to calculate the p value. (J) The expression of glucogenesis enzymes including pck1 , pcxa , pcxb , and fbp1b , in the liver in WT and Tg(hsp70:gonacin) at 70 dpf after 40°C heat shock for 1 h (n = 5 in each group). The columns represent fold changes of the relative mRNA levels in the Tg(hsp70:gonacin) group over its respective WT controls (mean ± SEM) ∗, p < 0.05; ∗∗, p < 0.01; n = 5. Unpaired Student’s t test was used to calculate the p value.

Techniques Used: Over Expression, Transgenic Assay, Expressing, Control



Similar Products

90
GenScript corporation ptol2-egfp vector cmv promoter
Overexpression of gonacin in the whole body could enhance the body growth, serum glucose, and food intake <t>of</t> <t>zebrafish</t> (A) Overexpression of gonacin in whole body by the establishment of gonacin transgenic zebrafish driven by <t>CMV</t> promoter. (B) The expression of gonacin was detected in the embryos of wild type (WT) and Tg(CMV:gonacin) at 8 dpf, using ef1a as an internal control. ∗∗∗, p < 0.001; Unpaired Student’s t test was used to calculate the p value. (C) Assessment of the food intake in Tg(CMV:gonacin) . The food intake was assessed in WT and Tg(CMV:gonacin) at 55 dpf (panel a, n = 15 in each group). ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001; two-way ANOVA with Sidak’s multiple comparisons test was used to calculate the p value. (D) The morphology of WT and Tg(CMV:gonacin) zebrafish at 50 dpf. Scale bar: 0.5 cm. (E) Body weight (left panel) and body length (right panel) of WT and Tg(CMV:gonacin) at 50 dpf. ∗∗, p < 0.01; ∗∗∗, p < 0.001 compared with WT (n = 10). (F) Overexpression of gonacin in whole body by the establishment of gonacin transgenic zebrafish driven by hsp70 promoter. (G) The expression of gonacin was detected in the ovary of wild type (WT) and Tg(hsp70:gonacin) at 70 dpf after after 40°C heat shock for 1 h (n = 5 in each group), using ef1a as an internal control. ∗∗, p < 0.01; Unpaired Student’s t test was used to calculate the p value. (H) Assessment of the food intake in Tg(hsp70:gonacin) . The food intake was assessed in WT and Tg(hsp70:gonacin) at 70 dpf (panel a, n = 15 in each group). ∗, p < 0.05; ∗∗∗∗, p < 0.0001, two-way ANOVA with Sidak’s multiple comparisons test was used to calculate the p value. (I) Assessment of the blood glucose in Tg(hsp70:gonacin) . The blood glucose was assessed in WT and Tg(hsp70:gonacin) at 70 dpf after 40°C heat shock for 1 h (n = 5 in each group). ∗∗, p < 0.01; Unpaired Student’s t test was used to calculate the p value. (J) The expression of glucogenesis enzymes including pck1 , pcxa , pcxb , and fbp1b , in the liver in WT and Tg(hsp70:gonacin) at 70 dpf after 40°C heat shock for 1 h (n = 5 in each group). The columns represent fold changes of the relative mRNA levels in the Tg(hsp70:gonacin) group over its respective WT controls (mean ± SEM) ∗, p < 0.05; ∗∗, p < 0.01; n = 5. Unpaired Student’s t test was used to calculate the p value.
Ptol2 Egfp Vector Cmv Promoter, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ptol2-egfp vector cmv promoter/product/GenScript corporation
Average 90 stars, based on 1 article reviews
ptol2-egfp vector cmv promoter - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Overexpression of gonacin in the whole body could enhance the body growth, serum glucose, and food intake of zebrafish (A) Overexpression of gonacin in whole body by the establishment of gonacin transgenic zebrafish driven by CMV promoter. (B) The expression of gonacin was detected in the embryos of wild type (WT) and Tg(CMV:gonacin) at 8 dpf, using ef1a as an internal control. ∗∗∗, p < 0.001; Unpaired Student’s t test was used to calculate the p value. (C) Assessment of the food intake in Tg(CMV:gonacin) . The food intake was assessed in WT and Tg(CMV:gonacin) at 55 dpf (panel a, n = 15 in each group). ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001; two-way ANOVA with Sidak’s multiple comparisons test was used to calculate the p value. (D) The morphology of WT and Tg(CMV:gonacin) zebrafish at 50 dpf. Scale bar: 0.5 cm. (E) Body weight (left panel) and body length (right panel) of WT and Tg(CMV:gonacin) at 50 dpf. ∗∗, p < 0.01; ∗∗∗, p < 0.001 compared with WT (n = 10). (F) Overexpression of gonacin in whole body by the establishment of gonacin transgenic zebrafish driven by hsp70 promoter. (G) The expression of gonacin was detected in the ovary of wild type (WT) and Tg(hsp70:gonacin) at 70 dpf after after 40°C heat shock for 1 h (n = 5 in each group), using ef1a as an internal control. ∗∗, p < 0.01; Unpaired Student’s t test was used to calculate the p value. (H) Assessment of the food intake in Tg(hsp70:gonacin) . The food intake was assessed in WT and Tg(hsp70:gonacin) at 70 dpf (panel a, n = 15 in each group). ∗, p < 0.05; ∗∗∗∗, p < 0.0001, two-way ANOVA with Sidak’s multiple comparisons test was used to calculate the p value. (I) Assessment of the blood glucose in Tg(hsp70:gonacin) . The blood glucose was assessed in WT and Tg(hsp70:gonacin) at 70 dpf after 40°C heat shock for 1 h (n = 5 in each group). ∗∗, p < 0.01; Unpaired Student’s t test was used to calculate the p value. (J) The expression of glucogenesis enzymes including pck1 , pcxa , pcxb , and fbp1b , in the liver in WT and Tg(hsp70:gonacin) at 70 dpf after 40°C heat shock for 1 h (n = 5 in each group). The columns represent fold changes of the relative mRNA levels in the Tg(hsp70:gonacin) group over its respective WT controls (mean ± SEM) ∗, p < 0.05; ∗∗, p < 0.01; n = 5. Unpaired Student’s t test was used to calculate the p value.

Journal: iScience

Article Title: Gonacin: A germ cell-derived hormone with glucogenic, orexigenic, and gonadal activities

doi: 10.1016/j.isci.2023.108065

Figure Lengend Snippet: Overexpression of gonacin in the whole body could enhance the body growth, serum glucose, and food intake of zebrafish (A) Overexpression of gonacin in whole body by the establishment of gonacin transgenic zebrafish driven by CMV promoter. (B) The expression of gonacin was detected in the embryos of wild type (WT) and Tg(CMV:gonacin) at 8 dpf, using ef1a as an internal control. ∗∗∗, p < 0.001; Unpaired Student’s t test was used to calculate the p value. (C) Assessment of the food intake in Tg(CMV:gonacin) . The food intake was assessed in WT and Tg(CMV:gonacin) at 55 dpf (panel a, n = 15 in each group). ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001; two-way ANOVA with Sidak’s multiple comparisons test was used to calculate the p value. (D) The morphology of WT and Tg(CMV:gonacin) zebrafish at 50 dpf. Scale bar: 0.5 cm. (E) Body weight (left panel) and body length (right panel) of WT and Tg(CMV:gonacin) at 50 dpf. ∗∗, p < 0.01; ∗∗∗, p < 0.001 compared with WT (n = 10). (F) Overexpression of gonacin in whole body by the establishment of gonacin transgenic zebrafish driven by hsp70 promoter. (G) The expression of gonacin was detected in the ovary of wild type (WT) and Tg(hsp70:gonacin) at 70 dpf after after 40°C heat shock for 1 h (n = 5 in each group), using ef1a as an internal control. ∗∗, p < 0.01; Unpaired Student’s t test was used to calculate the p value. (H) Assessment of the food intake in Tg(hsp70:gonacin) . The food intake was assessed in WT and Tg(hsp70:gonacin) at 70 dpf (panel a, n = 15 in each group). ∗, p < 0.05; ∗∗∗∗, p < 0.0001, two-way ANOVA with Sidak’s multiple comparisons test was used to calculate the p value. (I) Assessment of the blood glucose in Tg(hsp70:gonacin) . The blood glucose was assessed in WT and Tg(hsp70:gonacin) at 70 dpf after 40°C heat shock for 1 h (n = 5 in each group). ∗∗, p < 0.01; Unpaired Student’s t test was used to calculate the p value. (J) The expression of glucogenesis enzymes including pck1 , pcxa , pcxb , and fbp1b , in the liver in WT and Tg(hsp70:gonacin) at 70 dpf after 40°C heat shock for 1 h (n = 5 in each group). The columns represent fold changes of the relative mRNA levels in the Tg(hsp70:gonacin) group over its respective WT controls (mean ± SEM) ∗, p < 0.05; ∗∗, p < 0.01; n = 5. Unpaired Student’s t test was used to calculate the p value.

Article Snippet: Gonacin coding sequence with signal peptide sequence of zebrafish glucagon 1 (ATGATGGTAAGGATCTATGCTTTCATTGGACTTTTACTTCTCATCCTGATCCAGAGCAGCCTGCAG) was synthesized and cloned into pTol2-EGFP vector with CMV promoter by Genscript (China).

Techniques: Over Expression, Transgenic Assay, Expressing, Control